ABSTRACT
To compare the power of dyslipidemia diagnosis by different sets of cut points in the prediction of cardiovascular metabolic risk factors and identify the appropriate cut points for the diagnosis of dyslipidemia in children and adolescents in China. Data were obtained from the baseline survey of 'School-based Cardiovascular and Bone Health Promotion Program' in Beijing in 2017. Dyslipidemia was diagnosed by using two set of cut points. Receiver operating characteristic curve analysis was conducted to assess the power of dyslipidemia diagnosis by the two set of cut points to predict the prevalence of hypertension, obesity, high fat mass percentage and impaired fasting glucose. A total of 14 390 children and adolescents were in included in the study. The prevalence rates of high TC, high LDL-C, low HDL-C, and high TG in the participants were 2.7, 2.7, 14.4, and 3.7 according to 'Chinese Reference Standard', and 5.0, 3.7, 13.3, and 3.5 according to 'China Expert Consensus'. Low HDL-C and high TG defined by the 'Chinese Reference Standard' had better performance for the prediction of high fat mass percentage and obesity in boys, but worse performance in girls (<0.001). Using 'China Reference Standard' can increase the true positive rate in the prediction of obesity or high fat mass percentage in boys, and reduce the false positive rate in girls. The cut points for the diagnosis of dyslipidemia in Chinese children and adolescents need to be further validated by using national representative sample and in longitudinal study.
ABSTRACT
Objective:To evaluate the efficacy and safety of clip-with-endoloop method during endoscopic submucosal dissection (ESD) in treatment of early gastric angle cancer and precancerous lesions.Methods:A total of 59 patients with early gastric angle cancer or precancerous lesions underwent ESD from January 2018 to December 2018 were randomly divided into the routine ESD group ( n=28) and the clip-with-endoloop group ( n=31). The frequency of supplementary submucosal injection, ESD procedure time, area of the resected specimen, dissection time, submucosal dissection speed, complete resection rate and complications were compared between the two groups. Results:The frequency of supplementary submucosal injection in the clip-with-endoloop group was less than that in the routine ESD group (2.3±1.1 VS 3.7±1.4, t=4.557, P<0.001). There was no significant difference in the area of the resected specimen between the two groups (12.7±2.6 cm 2 VS 11.7±2.7 cm 2,t=1.485, P=0.143). The ESD procedure time (72.4±24.7 min VS 93.6±28.9 min, t=3.043, P=0.004) and dissection time (67.7±23.3 min VS 88.2±28.3 min, t=3.054, P=0.003) in the clip-with-endoloop group were significantly shorter compared with those in the routine ESD group. The submucosal dissection speed in the clip-with-endoloop group was higher than that in the routine ESD group (20.2±3.2 mm 2/min VS 14.3±3.4 mm 2/min, t=6.879, P<0.001). The complete resection rate was 100.0% in the both groups. No perforation or postoperative bleeding occurred in the two groups. The incidence of intraoperative bleeding in the clip-with-endoloop group was lower than that in the routine ESD group [19.4% (6/31) VS 35.7% (10/28), χ2=1.992, P=0.158]. Conclusion:Clip-with-endoloop method makes ESD procedures easier and faster, with a lower possibility of intraoperative bleeding in treatment of early gastric angle cancer.
ABSTRACT
OBJECTIVE@#To study the value of body fat mass measured by bioelectrical impedance analysis (BIA) in predicting abnormal blood pressure and abnormal glucose metabolism in children.@*METHODS@#Stratified cluster sampling was used to select the students aged 6-16 years, and a questionnaire survey and physical examination were performed. The BIA apparatus was used to measure body fat mass. Body mass index (BMI), body fat mass index (FMI), and fat mass percentage (FMP) were calculated. Fasting blood glucose level were measured.@*RESULTS@#A total of 14 293 children were enrolled, among whom boys accounted for 49.89%. In boys and girls, the percentile values (P, P, P, P, P, P, P, P) of FMI and FMP fitted by the LMS method were taken as the cut-off values. Based on the receiver operating characteristic curve analysis, the P values with a better value in predicting abnormal blood pressure and blood glucose metabolism were selected as the cut-off values for excessive body fat. When FMI or FMP was controlled below P, the incidence of abnormal blood pressure or abnormal glucose metabolism may be decreased in 8.25%-43.24% of the children.@*CONCLUSIONS@#The evaluation of obesity based on FMI and FMP has a certain value in screening for hypertension and hyperglycemia in children, which can be further verified in the future prevention and treatment of obesity and related chronic diseases in children.
Subject(s)
Adolescent , Child , Female , Humans , Male , Adipose Tissue , Blood Pressure , Body Composition , Body Mass Index , Electric Impedance , GlucoseABSTRACT
BACKGROUND@#Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons.@*METHODS@#The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software.@*RESULTS@#The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed.@*CONCLUSIONS@#The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.
ABSTRACT
The carriage rate and serotype distribution of Streptococcus pneumoniae (S. pneumoniae) in a healthy population in China remains unclear. In this study, we collected the oropharyngeal swabs from 513 individuals in Xinjiang, China. Real-time PCR targeting the lytA gene and 12 serotypes were assessed to identify S. pneumoniae carriage. The total carriage rate of S. pneumoniae was 70.4% (361/513). The most prevalent serotypes were 19B/F, 18B/C, 5, and 6A/B. The highest carriage rate of S. pneumoniae was noted in children aged 6-10 years (88.6%), which merits further attention. The co-colonization rate of two or more S. pneumoniae serotypes was 79.8% (264/331). This study aimed to investigate the baseline pneumococcal carriage rate among healthy individuals in China to improve our understanding of the epidemiology of S. pneumoniae.
Subject(s)
Adolescent , Adult , Child , Child, Preschool , Female , Humans , Infant , Male , Middle Aged , Young Adult , Carrier State , Epidemiology , Microbiology , China , Epidemiology , Cross-Sectional Studies , Pneumococcal Infections , Epidemiology , Microbiology , Prevalence , Real-Time Polymerase Chain Reaction , Serogroup , Streptococcus pneumoniae , Classification , GeneticsABSTRACT
Objective To compare the success rate, operation time, complication rate and the degree of tolerance of two kinds of endoscopic placement of small intestine decompression tube. Method 68 intestinal obstruction patients treated with transnasal ileus tube were randomly divided into 2 groups, group A and group B, 34 cases in each. Patients in group A were treated by endoscopic placement, while in group B placement was guided by nasal endoscope. Results The catheterization success rate and complications between the two groups have no statistical significance (P > 0.05) while the differences of catheter operation time (P < 0.05) and placement tolerance (P < 0.01) have statistical significance. Conclusion Endoscopic placement of small intestinal decompression tube has clinical application value while placement guided by nasal endoscope has certain advantages.
ABSTRACT
Objective To investigate characteristics of death and the life lost caused by diabetes mellitus among residents in Chongming County in Shanghai. Methods The death-cause monitoring data in 2005 -2014 from Chongming residents was analyzed; the indicators included mortality, standard mortality rate, potential years of life lost, the rate of potential years of life lost and average years of life lost. Results The average annual mortality rate was 37 .25 /100 000 in Chongming in 2005 -2014 , the mortality rate being on the rise during the last 10 years, and the cumulative growth of the mortality rate 94.24%.The annual average standardized mortality rate was 18.92/100 000, and the trend of rising during the 10 years was not statistically significant by APC (P=0.086).The aged group was the main population suffering from DM,those aged above 65 accounted for 81.95%of the total deaths caused by DM. The diabetes complication was the main direct cause of death, accounting for 67.97%of the total deaths, in which the proportions of non specified and diabetic nephropathy were 48.37% and 8.79% respectively. The potential years of life lost of diabetic was 17 393.76 person year in 2005 -2014 in Chongming, the potential years of life lost rate being 2 .62%, and the average years of life lost 10 .43 years:the life loss in men was more serious than that in women. Conclusion As the rising trend of diabetes in Chongming was gradually obvious, we should strengthen the 3-level prevention of diabetes and reduce the burden of disease with the aging of population.
ABSTRACT
<p><b>OBJECTIVE</b>To study the preventive effects of jinghua weikang capsule (JWC) on nonsteroidal anti-inflammatory drugs (NSAIDs) induced injury to the mucosa of the small intestine.</p><p><b>METHODS</b>Thirty-two Wistar rats were randomly divided into four groups, i.e., the blank control group, the model group, the JWC group, and the esomeprazole group. Diclofenac was administered to rats in the model group, the JWC group, and the esomeprazole group at the daily dose of 15 mg/kg. JWC and esomeprazole was respectively given to those in the JWC group, and the esomeprazole group one day ahead. Normal saline was given to rats in the blank control group. Rats were killed 3 days later. The pathological changes of the small intestine were observed by hematoxylin and eosin stain.</p><p><b>RESULTS</b>Compared with the blank control group, the general score for the small intestine (4.63 +/-0.52 vs 0.00 +/-0. 00) and the pathological score (4.00 +/-0.90 vs 0.00 +/-0. 00) obviously increased in the model group, showing statistical difference (P <0.05). Compared with the model group, the general score for the small intestine (1.88 +/-0.99) and the pathological score (2.11 +/-1.11) obviously decreased in the JWG group, showing statistical difference (P <0.05). Compared with the model group, the general score for the small intestine (2.75 +/-1.28) and the pathological score (2. 30 +/-0.94) obviously decreased in the esomeprazole group, showing statistical difference (P <0.05).</p><p><b>CONCLUSION</b>JWC could prevent NSAIDs induced injury to the mucosa of the small intestine.</p>
Subject(s)
Animals , Male , Rats , Anti-Inflammatory Agents, Non-Steroidal , Diclofenac , Drugs, Chinese Herbal , Pharmacology , Therapeutic Uses , Esomeprazole , Pharmacology , Therapeutic Uses , Intestinal Mucosa , Pathology , Intestine, Small , Pathology , Phytotherapy , Rats, WistarABSTRACT
OBJECTIVE To strengthen the management of hospital infection in order to prevent and control the hospital infection.METHODS Management organizations,various systems,knowledge training and monitorings should be strengthened.RESULTS Through the strengthening of hospital infection management,the sense of control and the hospital rules and regulations were improved.CONCLUSIONS The hospital medical staff improve their sense of control and management of hospital infection and strengthen the management standardization and institutionalization,and sustainably promote the management of hospital infection.
ABSTRACT
OBJECTIVE To explore the sterilizing effect of low-temperature vacuum formaldehyde.METHODS The test group used the own-produced 140 L low-temperature vacuum formaldehyde sterilizer for sterilization;and the control group used "Xinhua" hydrogen peroxide plasma sterilizer.Sterilization effect of the two groups was monitored by biological indicator.RESULTS After 50 sterilization procedures run in test group,the biological indicators the bacterial were all killed,the qualification rate of sterilization was 100%.But after 30 sterilization procedures run in control group,only 8 procedures were qualified,the qualification rate of sterilization was 26%.The sterilizing effect of the two groups was significantly different(P
ABSTRACT
In order to test the clinical capacity of hand-carried ultrasound (HCU) devices in elderly inpatients with heart disease, chamber sizes of heart structure, ventricular wall thickness and motion abnormality (WMA), mitral valve and tricuspid regurgitation evaluated by HCU devices in 401 elderly inpatients with heart disease were compared with those evaluated by comprehensive echocardiography (CE) devices. As a result, there was no significant difference in measurements of cardiac chamber dimensions or left ventricular ejection fraction between the two techniques. The HCU's WMA detection rate relative to the CE was 92.15%. Their conformable rates for detection of mitral and tricuspid regurgitation was 93% and 91.4% respectively. Therefore, we conclude that HCU is one of the practical modalities for diagnosis and monitoring in elderly inpatients with heart disease.
Subject(s)
Aged , Aged, 80 and over , Female , Humans , Male , Middle Aged , Echocardiography , Classification , Heart Diseases , Diagnostic Imaging , Inpatients , Monitoring, AmbulatoryABSTRACT
<p><b>OBJECTIVE</b>To characterize the deficiency of the mRNA expression of specific protein (SP3) gene in peripheral blood mononuclear cells (PBMCs) from Chinese patients with multiple sclerosis (MS) and study its correlation with the disease phenotypes.</p><p><b>METHODS</b>Fifty-six patients with definite MS were collected and total RNA was extracted from their PBMCs. Specific primers corresponding to SP3 gene were designed and the mRNA expression of SP3 gene was detected by reverse transcriptase-PCR (RT-PCR) method. The deficiency of SP3 expression was compared among MS patients, irrelevant disease group and normal controls.</p><p><b>RESULTS</b>Of the 56 MS cases, 23 (41.1%) were SP3-deficient. In contrast, the frequency of SP3-deficiency in normal subjects and irrelevant disease controls was 8.6% (5/35) and 14.3% (4/27), respectively. The frequency of the SP3-expression deficiency in MS patients was significantly higher than that in both control groups (P< 0.01). Within the MS cases, the scores of expanded disability status scale (EDSS) in the SP3-expressing subjects were significantly different from that in the SP3-deficient ones in the stable, but not in the active, phase of MS (P< 0.05).</p><p><b>CONCLUSION</b>Author's observation suggested that deficient expression of SP3 gene occurs in Chinese MS patients, and that the SP3 expression may correlate with the clinical manifestations of MS and play roles in its immunological pathogenesis.</p>
Subject(s)
Adolescent , Adult , Aged , Child , Female , Humans , Male , Middle Aged , Young Adult , Leukocytes, Mononuclear , Metabolism , Multiple Sclerosis , Genetics , RNA, Messenger , Genetics , Reverse Transcriptase Polymerase Chain Reaction , Sp3 Transcription Factor , GeneticsABSTRACT
<p><b>OBJECTIVE</b>To establish a novel model of lumbar disc degeneration on the early stage in the rhesus monkey using percutaneous needle puncture guided by CT.</p><p><b>METHODS</b>(1) Thirteen rhesus monkeys aged from 4 to 7 years, female 7 and male 6 were selected for establishing a model of the early stage of lumbar disc degeneration. (2)13 monkeys, 91 discs were divided into 3 groups: 64 discs from L1/2 to L5/6 were percutaneous punctured with a needle 20G as experimental group and 1 disc with a needle 15G as puncture control group and 26 discs were not be punctured from L6,7 to L7-S1 as control group. (3) Lumbar disc localization for needle puncture was guided by CT. All discs were examined by MRI, the HE, Masson's trichrome, Safranine-O and immunohistochemical staining of type II collagen before disc puncture and after puncture at 4, 8 and 12 weeks.</p><p><b>RESULTS</b>MRI: (1) Experimental group: Pfirmann's Grade I was shown at postoperation 4, 8 and 12 weeks; (2) Puncture control group: Grade III was shown at postoperation 4 weeks and Grade IV at 8 weeks; (3) CONTROL GROUP: Grade I was shown at postoperation 4, 8 and 12 weeks. Histological examination: (1) In experimental group, there was no any change at postoperation 4 weeks, and the cell population of the nucleus was decreased at 8 weeks and more decreased at 12 weeks in HE. (2) There was no any change at postoperation 4 weeks, the clefts among the lamellae of the annulus fibrosus (AF) were shown at 8 weeks and more wider of the clefts of AF at 12 weeks in Masson's trichrome. (3) No any change was shown at postoperation 4 weeks, proteoglycan were progressively decreased at 8 and 12 weeks in Safranine-O. (4) No statistically significant difference in positive rate was observed at 4 and 8 weeks compared with control group in immunohistochemical staining of type II collagen. There was statistical difference at 12 weeks compared with control group (P<0.05). In puncture control group postoperation 8 weeks, the morphology of cell of nucleus pulposus was not clear in HE. The wider clefts of lamellae of the AF were shown in Masson's trichrome. The proteoglycan was obviously decreased in Safranine-O. Immunohistochemical staining collagen II synthesized was decreased. In normal control group, no any change was shown at 4, 8 and 12 weeks.</p><p><b>CONCLUSIONS</b>The degeneration of lumbar intervertebral disc on the early stage could be induced by the percutaneous needle puncture (20G) to the annulus fibrosus. The assessment of disc degeneration on early stage is not shown on MRI and only confirmed by histological examination.</p>